There are three important sub-disciplines within bioinformatics involving computational biology:
New algorithms and statistics are created with which to assess relationships among members of large data sets is made possible;
of various including and analysis of this data and nucleotide and amino acid sequences, protein domains, and protein structures; and
Implementation and development of tools which enable efficient access and management of different types of information.
3 DATABASE DESCRIPTION:
[5] is a search and retrieval system that integrates information from databases at NCBI. These databases include nucleotide sequences, protein sequences, macromolecular structures, whole genomes, and MEDLINE, through PubMed. An is available for the Entrez System. For information on the databases that are including in Entrez see the [6]
is the NIH genetic sequence database. This is a major annotation collection of all publicly available DNA sequences. GenBank (at NCBI), together with the DNA DataBank of Japan (DDBJ) and the European Molecular Biology Laboratory (EMBL) comprise the International Nucleotide Sequence Database Collaboration. These three organizations are associated with each other in such a manner that they exchange data on a daily basis. GenBank grows at an exponential rate, with the number of nucleotide bases doubling approximately every 14 months. Currently, GenBank contains nearly 3 billion bases from over 47,000 species.
4 PREVIOUS RESEARCHES DONE:
Not much research has been done of specific IRES element that I doing research on. Few of the research work that are published are as mentioned below in this literature review.
4.1 MOTIFs pattern for IRES – Manduca sexta [8]
Internal ribosome entry sites (IRESes) of viral mRNAs comprise several hundred nucleotides. These nucleotides are highly structured, there is of proof indicating that very short nucleotide sequences, both naturally occurring and synthetic, can similarly mediate internal initiation of translation. In this study, they performed deletion and mutational analyses of IRES contained within the 720-nucleotide (nt) 5' leader of the Rbm3 mRNA and demonstrated that this IRES is highly modular, with at least 9 discrete cis-acting sequences. The different cis-acting sequences are included a 22-nt IRES module, a 10-nt enhancer, and 2 inhibitory sequences. This 22-nt sequence could function as an IRES when tested in isolation, and was demonstrated that it did not enhance translation by functioning as a transcriptional promoter, enhancer, or splice site [9].
In all there were 4 main cis-acting sequences which were further confirmed by their mutation in the context of the full IRES. But in this experiment, one of the inhibitory cis-acting sequences was contained within an upstream open reading frame (uORF), because of this containment the activity was probably masked by translation of this uORF. Further binding studies revealed that all 4 cis-acting sequences could bind specifically to distinct cytoplasmic proteins. Not only this but also the 22-nt IRES module was shown to bind specifically to 40 S ribosomal subunits. My research is not on cis acting sequences but on the sequence of IRES in Menduca sexta mid-gut. The result seen in this experiment carried out show that different types of cis-acting sequences mediate or adjust translation of the Rbm3 mRNA. Such an outcome suggests that one of the IRES modules contained within the 5' leader facilitates translation initiation. This is done by basically binding directly to 40 S ribosomal subunits. Hence it can be seen that here as well IRES plays an important role and can be used in such situations.
4.2 Further to this study, the optimal use of IRES in expression vectors was also done [10]. IT was seen that in the second cistron constructed bicistronic mRNAs is generally not translated unless special sequence named IRES is added. The addition of this IRES (Internal ribosomal site) is mandatory for expression. This is seen in higher eukaryotes where you do not find natural bicistronic mRNAs. Ribosome’s generally are cap dependent and cannot be recruited without 5’ UTR [11]. But in this case it was seen that ribosome was conscripted independently. This report deals with IRES found in HTLV-1 genome. A brief description of this is mentioned in this report. Study revealed that this IRE along with IRES seen in polio virus and encephalomyocarditis virus works optimally when they are added about 100 nucleotides after the termination codon of the first cistron. One factor that can be critically evaluated in this experiment that was carried out is that these IRES when added after 300 nucleotides up to 500 nucleotides spaces became totally inefficient. These results do not match or coincide with the standard admitted results that are seen otherwise. They are potent translator simulators. Their effects are emphasized in cells in which the normal mechanism of translation initiation is inhibited.
My project deals with the expression of IRES. I have to yet find out how this expression is carried out or how this expression is spotted.
4.3 In this study, the molecular mechanism of IRES mediated initiation and how they are actually used under certain physiological conditions by specific mRNAs for translation is explained [12]. It is stated under mitosis, apoptosis, hypoxia and some other viral infections how translation occurs or is repressed. In most eukaryotic mRNAs initiation of translation commences with 5’ end–dependent recruitment of 40S ribosomal subunits to the mRNA. The mRNA is thought to be scanned in the 5’ to 3’ direction by certain initiation factors nd 40S subunit carrying initator methionine-tRNA. The scan through the 5’ to 3’ direction until an appropriate start codon is encountered at which stage a 60S subunit joins to form an 80S ribosome that can decode the RNA into protein (Kozak 1989; Hershey and Merrick 2000).
IRESs are a small subset of mRNAs, usually in the 5’ NTR, that enable end-independent initiation to occur. IRES-containing mRNAs are not subjected to many of the regulatory mechanisms that control recruitment of most mRNAs to the translation apparatus.
Different mechanisms are explained for instance;
The canonical scanning mechanism of translation initiation,
Internal initiation,
Experimental test for IRES activity
Recently there are discoveries on IRES elements viral as well as cellular RNAs. Not all the discoveries are yet published but work on these element is being carried out. There is certain factor that must be applied to an RNA sequence to be termed IRES. The study states that the first, important factor is, the integrity of the translated dicistronic mRNA, which contains a suspected IRES element in the intergenic region, has to be examined to evaluate other possible reasons for translation of the downstream cistron. Care has to be taken if the enzymatic assays are used to monitor translation. The reason for doing this is that small amounts of broken dicistronic RNAs could yield functionally monocistronic RNA which in turn could translated into an active enzyme [13].
The second factor is IRES-mediated translation of the second cistron, that must be independent of translation of the first cistron. It’s important so that the mechanism of termination-reinitiation is ruled out. A particular convincing demonstration of IRES-mediated initiation involves the insertion of a suspected IRES into a circularized RNA, engineered to contain a single continuous open reading frame, so that multiple rounds of translation of the circle can be used as a measure of its integrity (Chen and Sarnow 1995).
4.4 One more literature on a cDNA clone encoding a subunit of the tobacco hornworm Manduca sexta (Ms) hemolymph (serum) ferritin (Fer) has been identified and sequenced [14]. This is in relation to my project as this study is done on Manduca sexta from which I have picked up the IRES element. In this experiment if we construe the amino acid sequence. It shows approximately 50% similarity to vertebrate Fer subunit sequences, and the nucleotide sequence contains a stem-loop structure in the 5' untranslated region that could serve as an iron-responsive element (IRE). There is a system in which the IRE through the stem-loop which exhibits high identity to vertebrate IRE that play an essential role in the control of Fer synthesis. My work is not on the Fer synthesis but it revolves round the element. This (Ms) Fer subunit lacks one of the three Tyr residues required for the rapid biomineralization of iron shown in vertebrate heavy-chain Fer. The ferroxidase comprised by the respective amino acid is not conserved, suggesting that the Ms Fer subunit more closely resembles the vertebrate light-chain subunit. A new technique called the Northern blot analyses indicate that the fer mRNA is expressed in the midgut, fat body and hemocytes, with the greatest expression in the midgut.
The element picked up for my study is from this midgut it’s a 347 base pair long sequence and it reads as follows:
CTACACCCTGCTACACAGCCAAGTGTTCTGCGAAATAAACATTTATAATTACGTTTCGTGATCGTCTCATTGCACGGCTGTTTTTATCTCCGCCGAGTCTCTTTGTTGAAAGTCGCCTTCTGCGCCAGTGTGTGTAAAGGCTGCACTTTCGACGGGACGTTATTTTATCTGCTATTATAATTATCCGCATCATTCGTTTCAGAAAAATGAACCCAATCACTTTCTTCGTTGCGTGCCTGTTGGCCCTCTGCGGCGCCGTCGCGGCCGACACTTGCTACCAGGACGTGTCGCTCGACTGCTCGCAAGTCTCCAACAGCCTAACCCTGCCCAACTGTAACGCGGTGTAC
[15]
4.5 More research is carried out on this, the closes match to my IRES element is Calpodes and further a dot plot of the same is plotted [16]. Holoferritin is easily visible in the vacuolar system of tissues that filter the hemolymph and, at least in Lepidoptera, is abundant in the hemolymph this is seen in insects. There is great diversity in the sequences secreting ferritins. For instance Lepidoptera and Diptera have high sequence diversity. This diversity was studied for the first time by analyzing sequences of cDNAs encoding two ferritin subunits from one species, Calpodes ethlius (Lepidoptera, Hesperiidae).
It was found that the insect that secreted ferritin subunits are of two types There is little resemblance between the two of them. Ferritin was isolated from iron loaded hemolymph of Calpodes ethlius fifth instar larvae by differential centrifugation. This is a process to isolation. The N-terminal amino acid sequences for the nonglycosylated subunit with Mr 24,000 (S) and the largest glycosylated subunit with Mr 31,000 (G) were determined. There were two subunits of the N-termini of which were different and were used to construct degenerate PCR primers. What PCR does is that it amplifies cDNA products from cDNA libraries from the midgut which secretes holoferritin and from the fat body which secretes iron-poor apoferritin. The G subunit most closely resembles the glycosylated ferritin subunit from Manduca sexta and the S subunit resembles the Drosophila small subunit. The S and G subunits from Calpodes were dissimilar and distinct from the cytosolic ferritins of vertebrates and invertebrates.
After this was done additional sequences were obtained by 5' and 3' RACE from separate fat body and midgut RACE libraries. It was seen that consensus IRE – Iron responsive element was encoded by the cDNAs. A calreticulin (mobilferrin)/integrin pathway would probably increase and facilitate the iron uptake, this was seen because of an integrin-binding RGD motif found in the G subunit and conserved in Manduca. Cisteine residues has been conserved by calpodes and other closely related insects so that fatty acids can be linked to it. Dynamic acylation of ferritin may slow but not prevent its passage out of the ER. PMID: 10560139 [PubMed - indexed for MEDLINE]
A comparision was made and the above study results were confirmed. It was seen that IRES from a Manduca sexta mid gut had quite a lot of similarities between them.
A chart to describe the above is pasted below:
The above chart shows the homologies with other genetic sequences in the GenBank. This can be done by using a software on the web named ANGIS -Australian National Genomic Information Service
One more site that I use for the purpose is National Center for Biotechnology Information (NCBI). When you see the chart, IRES of Manduca sexta AF 27092 has some similarity with calpodes L41723.
Hence a comparison is done between these two to pick up a shorter segment. This method is called the DOT PLOT.
A perfect example of the same is as below. A detailed study on this indicated that sequence ranging from 101 to 157 should be picked for further study.
The above shows a dot plot of the comparison and then a segment has to be picked by analyzing the above dot plot and it was decide that segment 101 to 157 should be picked for further analysis.
4.6 [17] When mRNA is translated protein is regulated. mRNA sequence are plays an important role. One such element is the internal ribosome entry site (IRES). It is proved that the 9-nt segment in the 5' leader sequence of the mRNA encoding Gtx homeodomain protein could function as an IRES. INorder to find out other sequences a specific procedure was designed that used retroviral vector. This vector is used to express dicistronic mRNAs encoding enhanced green and cyan fluorescent proteins as the first and second cistrons, respectively. The second cistron was indicative of IRES activity. A B104 cells were infected with two retroviral libraries that contained random sequences of 9 or 18 nt in the intercistronic region. Some sequences were recovered and this was reassayed for IRES activity. By using this two novel IRESes were identified by this procedure, and both contained segments with complementarity to 18S rRNA.
A new experiment was again done on it, in this when either of the IRES that was found was linked together the activity was enhanced. These synthetic IRESes were differentially active in various cell types. When you compare the properties with 9-nt IRES module from Gtx mRNA it was found to be identical. From these results it is quite evident that the short nucleotide sequences function’s as IRESes. Further more it also supports that some shorter functional modules can form cellular IRESes. This form of identification with specific expression properties of the IRES modules can be useful in the design of vectors for biotechnology and gene therapy
REFERENCES:
[1] The Computation of Biological Information: bioinformatics.weizmann.ac.il/cards/bioinfo_intro.html
[2] The Computation of Biological Information http://margot.weizmann.ac.il:3188/BCG
[3] Bioinformatics: http://bip.weizmann.ac.il/mb/tut/.html
[4] Flow Chart: biotech.icmb.utexas.edu/pages/bioinform/BIintro.html
[5] Entrez :
[6] Bioinformatics:
[7] Genbank :
[8] The Internal Ribosome Entry Site (IRES) Contained within the RNA- binding Motif Protein 3 (Rbm3) mRNA IS Composed of Functionally Distinct Elements
Stephen A. Chappell and Vincent P. Mauro
From the Department of Neurobiology, The Scripps Research Institute, and The Skaggs Institute for Chemical Biology, La Jolla, California 92037
[9] Walczak R, Westhof E, Carbon P, Krol A: A novel RNA structural motif in the selenocysteine insertion element of eukaryotic selenoprotein mRNAs. RNA 1996 2: 367-379.
[10] The Optimal Use of IRES (Internal Ribosome Entry Site) in expression vectors
Joe Attal, Marie-Claire Theron, Louis Marie Houdebine *
Genetic Analysis: Biomolecular Engineering 15 (1999) 161-165
[11] Van der Velden AW, Thomas AA: The role of the 5' untranslated region of an mRNA in translation regulation during development. Int J Biochem Cell Biol 1999 31: 87-106.
[12] Internal ribosome entry sites in eukaryotic mRNA molecules Christopher U.T. Hellen1,3 and Peter Sarnow2,3
Department of Microbiology and Immunology, Morse Institute for Molecular Genetics, State University of New York
Health Science Center at Brooklyn, Brooklyn, New York 11203, USA;
Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, California 94305, USA
[13] Pesole G, Mignone F, Gissi C, Grillo G, Licciulli F, Liuni S: Structural and functional features of eukaryotic mRNA untranslated regions.
Gene 2001 276: 73-81.
[14] Manduca sexta hemolymph ferritin: cDNA sequence and mRNA expression.
Department of Biochemistry, University of Arizona, Tucson 85721, USA
[15] ANGIS - PMID: 8682313 [PubMed - indexed for MEDLINE
[16] Secreted ferritin subunits are of two kinds in insects molecular cloning of cDNAs encoding two major subunits of secreted ferritin from Calpodes ethilius.
Nichol H, Locke M
Department of Zoology, University of Western Ontario, London, Canada.
Insect Biochem Mol Biol. 1999 Nov; 29(11):999-1013
Gene. 1996 Jun 26;172(2):255-9.
[17] Identification of two short internal ribosome entry sites selected from libraries of random oligonucleotides
Geoffrey C. Owens*,, Stephen A. Chappell, Vincent P. Mauro, and Gerald M. Edelman*,
* The Neurosciences Institute, 10640 John Jay Hopkins Drive, San Diego, CA 92121; and Department of Neurobiology, The Scripps Research Institute, and The Skaggs Institute for Chemical Biology, 10550 North Torrey Pines Road, La Jolla, CA 92037