Objectives:To amplify a 500bp fragment of lambda DNA. To understand the principles and the application of Polymerase Chain Reaction. To analyses the PCR by using Agarose Gel Electrophoresis.

Experiment 5 and 6

Title: Polymerase Chain Reaction and analysis of Polymerase Chain Reaction sample.

Objectives:

To amplify a 500bp fragment of lambda DNA.
To understand the principles and the application of Polymerase Chain Reaction.
To analyses the PCR by using Agarose Gel Electrophoresis.

Introduction:

Polymerase Chain Reaction (PCR) is a molecular biology technique that invented by Kary R. Mullis in 1985. The PCR is a technique used to replicate a fragment of DNA so as to produce many copies of a particular DNA sequence. PCR is commonly employed as an alternative to “gene cloning as a mean of amplifying genetic material for gene sequencing, and is also used to measure gene expression. The PCR only used a small amount of DNA molecule to amplify. However, it is an in vitro technique.

A PCR mixture consists of four key components- two primers(about 20 nucleotides long), a target DNA sequence(about 100 to 5000 base pair), a thermotable DNA polymerase(AmpliTaq polymerase, which can remain stable at 95oC or higher), and four deoxynucleotides ( dGTP,dATP,dCTP,dTTP). These components are added to a water and buffer mixture. As a little as 25 or 50 μl of this mixture may be used as a cost-cutting strategy, but 100μl is a more common amount. Volume not withstanding, the critical requirement is to maintain constant final concentrations of the reagents.

The two strands of the DNA are separated by heating and short sequences of a single DNA strand (primers) are added, together with a supply of free nucleotides and DNA polymerase obtained from a bacterial that can withstand extreme heat. For instance, a special DNA polymerase-Taq polymerase isolated from Thermus aquaticus which is living in hot springs can withstand high temperature used to denature the template DNA. In a series of heating and cooling cycles, the DNA sequence doubles with each cycle and is thus rapidly amplified. The product generated from the PCR is analyzed by agarose gel electrophoresis.

The PCR have three steps are repeated for 30 or 40 cycles. The cycles are done on an automated Thermal cycler, which rapidly heats and cools the test tubes containing the reaction mixture. Each step -- Denaturation (alteration of structure), annealing (joining), and extension -- takes place at a different temperature:

Denaturation: At 94°C, the double-stranded DNA melts and opens into single-stranded DNA.
Annealing: At 54°C, hydrogen bonds form and break between the single-stranded "primer" and the single-stranded "template." (The template provides the pattern to be copied.) The more stable bonds last longer and on that little length of double-stranded DNA (the joined primer and template), the polymerase attaches and starts copying the template.
Extension: At 72°C, the polymerase works best. As a result, the attraction, created by the hydrogen bonds, of the primers to the template is stronger than the forces breaking these attractions. The upshot is that bases complementary to the template are coupled to the primer.

Materials and Methods:

DNA sample(λ DNA – 0.1μg/ml)
Primer 1:5’ GATGAGTTCGTGTCCGTACAACTGG 3’
Primer 2:5’ GGTTATCGAAATCAGCCACAGCGCC 3’
Nucleotide mix (dATP, dCTP, and dTTP – 1.25 mM each)
Taq DNA polymerase(5U/μl) and buffer
25mM MgCl2
Sterile mineral oil
1kb ladder (0.05 μg/μl)
Ethidium bromide
dH2O

Experiment 5

1. PCR mixture:

2. Each group need prepare one tube.

3. All the PCR components added into the small tube (PCR tube), then put into PCR machine approximately 2 hours.

4. The sample has to keep at -20oC for ...

This is a preview of the whole essay

Materials and Methods:

DNA sample(λ DNA – 0.1μg/ml)
Primer 1:5’ GATGAGTTCGTGTCCGTACAACTGG 3’
Primer 2:5’ GGTTATCGAAATCAGCCACAGCGCC 3’
Nucleotide mix (dATP, dCTP, and dTTP – 1.25 mM each)
Taq DNA polymerase(5U/μl) and buffer
25mM MgCl2
Sterile mineral oil
1kb ladder (0.05 μg/μl)
Ethidium bromide
dH2O

Experiment 5

1. PCR mixture:

2. Each group need prepare one tube.

3. All the PCR components added into the small tube (PCR tube), then put into PCR machine approximately 2 hours.

4. The sample has to keep at -20oC for experiment 6.

Methods of experiment 6

1. 1% agarose gel is cast.

2. The samples are mix on Parafilm, and then load into the gel.

3. The gel is run at voltage 80-90V for ~ 30-40 minutes.

4. The gel is stained with ethidium bromide. (Please wear glove) and your gloves need to throw outside the lab.

5. The gel is washed with water after staining for awhile then your result view under the UV transilluminator.

Results and discussions:

Lane

1 2 3 4 5 6 7 8 9 10 11 12

Figure: Photograph of Agarose Gel on run with TBE (Tris-borate-EDTA) buffer.

Explanations:

Lane 1 is a DNA marker to determine the PCR samples base pairs. The lane 2 and lane 3 are PCR samples. Both have same base pairs. We can’t estimate the actual base pairs value because we run the gel only 30 minutes. The dye that used to run the agarose gel is to determine how far the DNA fragment can run on the gel. We used 500bp fragment of lambda DNA and the amplification PCR product is 500bp.

PCR begins with a mixture containing a double strand DNA template, a pair of short single strand of DNA oligonucleotide primers, a pool of the four dNTPs, and a heat-resistant DNA polymerase, Taq Enzyme. The reaction is carried out in a computer-regulated heating block, a thermal cycler, which permits rapid, controlled heating & cooling temperature. The primers are chosen so that they are complement to opposite ends of a short stretch base of DNA containing the gene region of interest.

In this experiment, the double-stranded DNA has to be heated to 94-96°C (or more than 96°C if extremely thermostable polymerases are used) in order to separate the strands. This step is called denaturing; it breaks apart the hydrogen bonds that connect the two DNA strands. Prior to the first cycle, the DNA is often denatured for an extended time to ensure that both the template DNA and the primers have completely separated and is now single-strand only. Time that usually used about 1-2 minutes, but up to 5 minutes.

After separating the DNA strands, the temperature is lowered so the primers can attach themselves to the single DNA strands. This step is called annealing. The temperature of this stage depends on the primers and is usually 5°C below their melting temperature (45-60°C). A wrong temperature during the annealing step can result in primers not binding to the template DNA at all, or binding at random. Time that estimate is 1-2 minutes.

The annealing temperature approximate is about 58-72oC. The annealing temperature can be approximated for oligonucleotides of 25 bases or less as follows:

Tm (melting temp) = 2oC for every A or T + 4oC for every G or C

Ta (annealing temp) = Tm - 5oC

Finally, the DNA polymerase has to copy the DNA strands. It starts at the annealed primer and works its way along the DNA strand. This step is called extension. The elongation temperature depends on the DNA polymerase. The time for this step depends both on the DNA polymerase itself and on the length of the DNA fragment to be amplified. This step takes 1 minute per thousand base pairs. A final elongation step is frequently used after the last cycle to ensure that any remaining single stranded DNA is completely copied. This different from all other elongation steps but this step take longer time, about 10-15 minutes.

Figure 1: The Polymerase Chain Reaction (PCR).

The PCR product can be identified by its size using agarose gel electrophoresis. Agarose gel electrophoresis is a procedure that consists of injecting DNA into agarose gel and then applying an electric current to the gel. The smaller DNA strands move faster than the larger strands through the gel toward the positive current. The size of the PCR product can be determined by comparing it with a DNA ladder, which contains DNA fragments of known size, also within the gel. In this experiment, we used 1kb DNA ladder to determine the DNA sample fragment sizes.

Primer Design means proper design of primers is critical to successful PCR amplifications. The general features of well-designed primers are listed below:

Primer should contain 15-30 nucleotides in the complementary region (3’-end of the molecule)
Long (4-30 base pairs) non-complementary 5' tails or linkers.
Primer should have a random base distribution with average GC content.
Base pairing to the target at the 3’-end of the primer is absolutely critical.
AT rich and GC rich regions should be avoided if possible.
Internal secondary structure (i.e. intrastrand base-pairing) should be avoided if possible.
The melting temperatures (Tm) of primers should be between 65 and 70 °C. This temperature should be calculated for the region of specific hybridization.G and C contents should be between 40-60%.
The PCR annealing temperature should generally be 10 – 15 degrees lower than the Tm. However it should be chosen empirically for individual conditions.
Inner self-complementary hairpins of that more than 4 and of dimers more than 8 should be avoided.
3’ terminus that it must not be complementary to any region of the other primer or even the same primer used in the reaction and must provide correct base matching to DNA template.

Polymerase chain reaction is not perfect, and errors and mistakes can occur. These are some common errors and problems that may occur. There were some polymerase errors. For instance, Taq polymerase lacks a 3' to 5' exonuclease activity. This makes it is impossible for it to check the base it has inserted and remove it if it is incorrect, a process common in higher organisms. This in turn results in a high error rate of approximately 1 in 10,000 bases, which, if an error occurs early, can alter large proportions of the final product. Other polymerases are available for accuracy amplification. For instances, the polymerases with 3’to 5’ exonuclease activity include: KOD DNA polymerase, a recombinant form of Thermococcus kodakaraensis KOD1.

Besides that, the size limitation of DNA fragments. The PCR works readily with DNA of lengths two to three thousand base pairs, but above this length the polymerase tends to fall off and the typical heating cycle does not have enough time for polymerisation to complete. The non specific binding of primers is always a possibility due to sequence duplications, non-specific binding and partial primer binding, leaving the 5' end unattached. This is increased by the use of degenerate sequences or bases in the primer. Manipulation of annealing temperature and magnesium ion which stabilise DNA and RNA interactions concentrations can increase specificity.

Some precaution steps we need to take care while we run the PCR.

PCR is very sensitive, need measures adequately to avoid contamination from other DNA present in lab environment such as bacteria, viruses, own DNA and others.
While prepare the DNA sample, the reaction mixture must performed in separate areas.
Prepare the reaction mixture, a laminar flow cabinet with UV lamp is recommended.
Fresh gloves should be used for each PCR step as well as displacement pipettes with aerosol filters.
The reagents for PCR should be prepared separately and used solely for this purpose.

PCR normally used in genome sequencing, including the Human Genome Project. Using random primers, the entire genome of an organism can be amplified in pieces. Once the pieces are amplified, they must be sequenced and then put back together to determine the genome sequence. Besides that, the PCR has a lot of advantages in healthcare industry. For instance, the medical diagnosis and genetic testing used PCR. PCR used to detect and identify bacteria and viruses that cause infections such as tuberculosis, chlamydia, viral meningitis, viral hepatitis, HIV, cytomegalovirus and many others. Once primers are designed for the DNA of a specific organism, using PCR to detect the presence or absence of a pathogen in a patient’s blood or tissues is a simple experiment. The genetic testing for PCR used to determine whether patients carry a genetic mutation that could be passed on to their children. For example, the mutation that causes cystic fibrosis.

Conclusion:

PCR is a technique used to replicate a fragment of DNA so as to produce many copies of a particular DNA sequence.
Three stages for the PCR such as denaturation, annealing and extension.
Primer design in the PCR to avoid formation of primer dimer.
Two types of primers need in PCR such as reverse primer and forward primer.
The product of PCR can analyze on the agarose gel electrophoresis.
PCR is used widely in: