1.5 Huntington’s disease mechanism specific to PC12 studies
The presence of intranuclear mutant huntingtin causes multiple cellular defects in PC12 cells (Wyttenbach et al, 2001). Intranuclear mutant huntingtin can interact with other nuclear molecules and by interfering with gene expression result in multiple cellular defects.
Stable inducible neuronal PC12 cell lines that express GFP-tagged huntingtin exon 1 were created with 23, 43, 53 and 74 CAG repeat lengths (Wyttenbach et al, 2001).The PC12 cell lines displayed many of the features of HD seen in vivo. The polyQ expansion is linked with aggregate formation with an EM structure similar to that observed in vivo and reduced neurite outgrowth. It was also shown that in cycling PC12 cells, the aggregates were first generated in the nucleus followed by a slow rise in the proportion of cells with both nuclear and cytoplasmic aggregates whereas in post-mitotic PC12 cells, aggregates were present in the nucleus but not in the cytoplasm. This demonstrates that the nucleus is the preferred location for aggregate production (Wyttenbach et al, 2001).In previous studies on Huntington’s disease by using htt exon 1, large fragments of HD gene products does not cause inclusion production or cell death in cell culture models. Studies have shown that in PC12 cells transfected with 150 polyglutamine repeats had a diffuse nuclear distribution of huntingtin (Li et al, 1999).Studies have shown that 6 days after huntingtin transfection,intranuclear aggregates was seen at its peak in cultured primary neurons(Saudou et al,1998).It has been thought that the association between cellular defects and the diffuse nuclear localization of 150 Q favours the concept that the nuclear location of polyglutamine protein is sufficient to cause cellular toxicity(Klement et al,1998).Studies have shown that PC12 cells that contain 150Q repeats demonstrate enhanced cell death, susceptibility to the apoptotic agent staurosporine,abnormal morphology and a dysfunction in neurite development. In addition there is also degeneration of neuronal processes. Furthermore this cell line shows that the intranuclear location of huntingtin affects gene expression.
1.6 Dictyostelium discoideum
D. discoideum is a soil dwelling social amoeba which has been studied for the past 50 years. Use of an axenic strain has contributed to our understanding of many cellular processes such as cytokinesis, motility, phagocytosis, chemotaxis and signal transduction. This amoeba is used because it can easily and cheaply be cultured in the lab. The gene dense chromosomes of this organism encode approximately 12,500 predicted proteins and a high percentage of these proteins consist of long repetitive amino acid tracts (Elchinger et al, 2005).The D. discoideum is one of the earliest branches from the last common ancestor of all eukaryotes.
The genome of D.discoideum has been fully sequenced .Introns are rare and promoters and introns are quite short (Elchinger et al, 2005). In dictyostelium exons, there are plentiful amounts of tandem repeats of trinucleotides and these correspond to repeated sequences of amino acids particularly glutamine and asparagine (Elchinger et al, 2005).
Overall these repeats or simple sequence tracts of amino acids exist in 34 % of predicted proteins .It is believed that nucleotide expansion is one of the main reasons why these repeats occur and is selected at the protein level. The distribution of these repeats and simple sequence tracts occur in a non-random fashion and most proteins present with no features or 2 or more features which demonstrates that they are tolerated only in certain types of protein. Because of the AT rich nature of D.discoideum the preferred codon for glutamine is CAA rather than CAG found in humans.
The D.discoideum grow as individual independent cells by ingesting bacteria and yeast which they track by chemotaxis.In the presence of adverse conditions such as starvation ,approximately 100,000 cells chemotax to form multicellular structures which consists of a fruiting body with a cellular cellulose stalk supporting a bolus of spores. There are approximately 68 D.discoideum genes which are incorporated into an uninterrupted polygutamine stretch containing 40 or more residues and therefore cause the initiation of HD in human patients.
2 Aim
The purpose of the overall research project is try to understand how D. discoideum is able to withstand a huge number of proteins containing polyglutamine stretches in the disease range of HD patients and the ability to exploit this in a treatment for HD.The genome sequencing of this social amoeba has demonstrated that this organism can withstand proteins containing extended poly Q stretches with roughly about 68 genes consisting of an uninterrupted poly Q stretch from 40 to 62 Q that are in the human HD disease range. The repeats above 40 Q in social amoeba exactly match to only one protein in humans. The overall research project also focuses whether there are binding proteins that have the ability to bind to and stabilise mutant length polyglutamine in this social amoeba. In addition the overall research is to find out whether D.discoideum has a mechanism for tolerating long polyglutamine tracts that could be developed as a treatment for HD. The objective of my project is to subclone a synthetically generated CAAX 100 repeat construct into a mammalian expression vector (pcDNA DEST-53) using the Gateway system (Invitrogen) to make an entry clone. An expression clone will be generated by carrying out an LR recombination reaction between an entry clone and a gateway destination vector. Colonies will be selected and these are the transformed Escherichia coli cells and plasmids are prepared. The plasmids construct will be sequenced to confirm its integrity and transfected into PC12 cells.pENTR-gus is a positive control for the LR recombination reaction. The gus protein has 603 amino acids and has a molecular weight of 68.4 kDa.An LR reaction with pENTR-gus and a destination vector produces hundreds of colonies. The Gus gene consists of a shine-Dalgarno and kozak sequence in frame with the attl1 site, so this gene can be expressed as a fusion protein in PC12 cells. This gus gene will be transferred into the destination vector pcDNA-DEST 53 and this construct will be transfected into PC12 cells. Various polyglutamine repeat-containing constructs are over-expressed in PC12 cells which include human normal and mutant huntingtin and partial cDNA of naturally occurring D.discoideum long polyglutamine-containing proteins. Cells that have been transformed will be determined by fluorescence microscopy. Fluoresence microscopy of living cells are carried out to confirm whether the cells are transformed and establish the cellular location of GFP-fusion proteins .Another hypothesis is to determine whether these fusion proteins cause cellular aggregation or alterations to normal cellular physiology in PC12 mammalian cells.
3 Methods
3.1 Clonase reaction (Invitrogen protocol)
The clonase reaction involved transferring a gateway entry clone construct containing 100 CAA repeats that had been synthetically made by a company called GeneArt into a mammalian expression destination plasmid pcDNA -DEST 53. The construct is called variant-CAA X100-N-terminal. The concentration calculated was 200ng/µl and the volume used was 0.75 µl.All these reagents came from the Invitrogen Company. 150ng of the entry clone construct containing 100 CAA repeats, 150 ng of pcDNA -DEST 53 and 6.25 µl of TE buffer were added to a microcentrifuge tube and mixed at room temperature. 2 µl of LR clonase II enzyme mix reaction was added to each of the entry clone, destination vector and TE buffer separately. These were then vortexed and microcentrifuged.The reaction mixture was incubated for 1 hour at 25°C. 1 µl of proteinase K solution was added to each sample and vortexed.The samples were then placed in the incubator at 37 °C for 10 minutes.
3.2 Transformation reaction (Invitrogen protocol)
The LB broth base with agar was made according to the instructions on the LB container. This was then autoclaved for 20 minutes at 121°C. The LB broth base was then added to two plates and 100 µg/µl of ampicillin was measured and poured to two of these plates. 10pg of DNA was added to each of the aliquots of one shot stb13 chemically competent Escherichia coli cells and was mixed gently. The vial was then incubated on ice for 30 minutes. The cells were heat shocked for 45 seconds at 42°C without shaking. The vials were removed from the waterbath and placed on ice for 2 minutes.250 µl of SOC medium was added. The vials were placed in a shaking incubator at 37°C for 1 hour at 225 rpm.
25 µl of each transformation was spread on a prewarmed selective plate and incubated overnight at 37°C. This was repeated for 100 µl of each transformation. These plates were placed in the incubator inverted at 37°C overnight. The following day, colonies were counted.
3.3 Minipreps
Minipreps are carried out to isolate plasmid DNA from bacteria on a smaller scale. The miniprep protocol was obtained from Qiagen. The LB broth base (catalogue number: 12780-052 from Invitrogen) was made according to the instructions on the LB container and this was autoclaved.5 ml of LB was added to each of the 2 eppendorph tubes. A single colony from the plate was inoculated with 5 ml of LB broth base and 100µg/µl of ampicillin.The eppendorph tubes were incubated overnight at 37 °C in a shaking incubator at 225 rpm.Pelleted bacterial cells were resuspended in 250 µl buffer P1 by vortexing and transferred to a microcentrifuge tube.250 µl of buffer P2 was added to this.350 µl of buffer N3 was also added to this and mixed immediately. This was then centrifuged for 10 minutes at 13,000rpm.The supernatant was pipetted into a QIAprep spin column. This was centrifuged for 45 seconds and the column flow-through was discarded. The QIAprep spin column was washed by adding 0.75 ml of buffer PE and centrifuged for 45 seconds. The flow through was discarded and placed in the microcentrifuge for 1 minute .The QIAprep spin column was placed in a sterile 1.5 ml centrifuge tube. The plasmid DNA was eluted by adding 50 µl buffer EB to each QIAprep spin column and this was then centrifuged. The concentrations of plasmid DNA was obtained using a spectrophotometer at 260 and 280 nm. Plasmid DNA was sent to a company who returned the sequence files that I analysed using chromas software.
3.4 Midipreps
Midipreps were done to isolate plasmid DNA from bacteria on a much larger scale. A colony from a selective agar plate labelled as pcDNA DEST- 53+ CAA x100 was inoculated into 5 ml of LB medium and 100µg/ µl of ampicillin.The same colony was used for minipreps and midipreps. This was put in a shaking incubator overnight at 37°C .200 µl of this culture was added to 50 ml of LB medium consisting of ampicillin.This was placed in a shaking incubator at 37°C overnight.Midipreps were created following the instructions for Qiagen Hispeed plasmid midiprep kits. Plasmid DNA absorbances were measured to determine the purity of the plasmid DNA sample.
3.5 Culturing PC12 cells
PC12 cells obtained from rat adrenal phaeochromocytoma were cultured following the instructions given by the ECACC website. The culture medium consisted of RPMI 1640, 2mM glutamine, 10% of horse serum, 5% foetal bovine serum and 1 % of penicillin/streptomycin. The cells were fed within one to three days and split. PC12 cells were maintained according to the ECACC protocol at 37 °C and 5% CO2. Every 2 weeks, PC12 cells from the flask were pipetted into a 50 ml falcon tube. This falcon tube was placed in the centrifuge at 500 rpm for 5 minutes and taken out of the centrifuge. 3ml of trypsin was pipetted into the 50 ml falcon tube and 3 ml of fresh media was pipetted into the trypsinised tube and left on the bench for half an hour.15ml of fresh media were pipetted into a new 50 ml falcon tube and 1.5 ml of PC12 cells were pipetted from the 50 ml falcon tube and also put into this new 50 ml falcon tube. This was done to homogenise the PC12 cells. A volume of acetic acid was added to 5mg of collagen type IV (Sigma) and placed on a roller for 3 hours until well dissolved. 5ml of chloroform was added to this mixture and allowed to stand overnight in the cold room. The following day, the top layer containing collagen solution was aseptically removed. 1 ml of collagen diluted with sterile milliQ water was placed in each of the 12 wells and placed in the incubator at 37°C.The following day, collagen was removed and dried at 37 °C.The 12 wells were washed with PBS and dried. Just before transfection, PC12 cells were grown in collagen IV coated 12 well plates and 2ml of RPMI media.800 µl of PC12 cells were pipetted into each of the 12 wells. These flasks were left in the incubator at 37°C overnight. Cells were grown in 0.01% bovine collagen so that these PC12 cells can easily adhere to the plates. In the absence of collagen, PC12 cells stick poorly to plastic and grow in tiny clusters of loosely attached cells.
3.6 Transfection (Invitrogen Company)
Plasmid DNA (1.6 µg) was diluted with suitable volumes of opti-MEM I media.Lipofectamine 2000 was diluted with appropriate volumes of opti-MEM I media. This was incubated for 5 minutes at room temperature. After the 5 minute incubation, the diluted DNA was mixed with diluted lipofectamine 2000 and incubated for 20 minutes at room temperature. 200 µl of complexes were added to each well containing cells and medium. The cells were incubated at 37°C for 18 hours. These are the constructs that I used for the transfection experiment: plasmid midiprep 53.1 CAAX100 pcDNA-DEST 53.1 20/05/2008 341 ng/ µl,plasmid midiprep 53.2 CAAX75 pcDNA-DEST 53.2 20/05/2008 349 ng/ µl ,Q62N in pcDNA-DEST 53 midi 1 17/07/2007 and Plasmid midiprep Gus control in pcDNA-DEST 53 30/07/2008.
3.7 Fixing cells for GFP-fusion protein localisation (Invitrogen)
The day after transfection, media was removed from cells grown on 12-well plates on collagen.400 µl of 4% PFA/PBS was pipetted into each of the 12 wells. This is paraformaldehyde fixative made up in phosphate buffered saline. This was incubated for 10 minutes. The wells were washed with PBS.1 ml of 1% Triton/PBS was pipetted into wells and left for 5 minutes.2 µl of Hoesch nuclear stain made up with PBS and 400 µl of this solution mix was pipetted into each of the 12 wells and incubated for 20 seconds. The wells were washed with PBS. The coverslips were placed with cells facing down mounting medium on a glass slide. Slides were stored in the dark to retain fluorescence.
3.8 Testing for GFP fluoresence
A Zeiss Azioplan microscope was used to test for fluorescent cells. The total number of cells was counted on each coverslip and excitation of the Hoechst stain was used to find cell nuclei on the coverslip.
4 Results
A gateway entry clone construct with 100 CAA repeats was successfully transferred into the destination vector pcDNA-DEST 53.The constructs made were plasmid DNA CAAX100 in pcDNA-DEST 53 and plasmid DNA CAAX 75 in pcDNA-DEST 53.Concentrations of DNA in pcDNA-DEST 53 were determined. Plasmid DNA was sent on both occasions after minipreps and midipreps to a company who returned the sequence files that I analysed using chromas software. The sequences showed for the constructs plasmid DNA CAAX100 in pcDNA-DEST 53, plasmid DNA CAAX 75 in pcDNA-DEST 53. and Gus control in pcDNA-DEST 53 with the insert was in frame with respect to pcDNA-DEST53.Q62N in pcDNA-DEST 53 and Gus control in pcDNA-DEST 53(which were made by 2 other students) and pcDNA-DEST 53 containing 100 CAA and 75 CAA repeats were transfected into PC12 cells. In PC12 cells transfected with Q62N and pcDNA-DEST 53 containing 100 CAA and 75 CAA repeats, faint perinuclear GFP fluorescence could be seen whereas pcDNA-DEST 53 containing the Gus control demonstrated faint diffuse fluorescence and in some of these PC12 cells there was no GFP signal.
4.1 Concentrations of DNA in pcDNA-DEST 53 with 100 and 75 CAA repeats.
95 µl of pcDNA-DEST 53 with 100 CAA repeats were measured using the p200 pipette.5 µl of sterile milliQ water was measured using p20 pipette. These were measured into the cuvettes.Absorbances at 260nm and 280 nm and concentrations were determined by using the spectrophotometer. This was also repeated for pcDNA-DEST 53 with 75 CAA repeats. A synthetically generated CAAX repeat construct was cloned into a mammalian expression vector using the gateway system (Invitrogen) to make an entry clone. A pcDNA-DEST53 with 75 and 100 CAA repeats were made. Concentrations of these plasmid DNA were determined and sequenced to determine the number of CAA repeats in each construct.
Table 1: DNA quantification of plasmid DNA with 100 and 75 CAA repeats in pcDNA-DEST 53 from minipreps.
Table 2: DNA quantification of plasmid DNA with 100 and 75 CAA repeats in pcDNA-DEST 53 from minipreps.
The DNA concentrations did not match up with Dr Hodges’ DNA quantifications and a typical plasmid DNA yield of a miniprep is 20-30 µg which fits in with Angela’s DNA quantification. This may be due to possible sources of error which is further discussed in the discussion page. The ratios of the A260/A280 absorbances shows that in both constructs the ratio is between 1.8 and 1.9 which demonstrates pure plasmid DNA.Sequencing of the two minipreps of the Q100 and Q75 fragments in pcDNA-DEST 53 showed that both of these constructs were in frame in the pcDNA-DEST 53.One miniprep contained 100 CAA repeats whereas the other miniprep contained 75 CAA repeats. It is thought that the miniprep with the few CAA repeats had missing bases in the polyglutamine repeat. This may be due to my inaccurate techniques in adding the entry clone containing the gene of interest when carrying out the LR recombination reaction while following the clonase protocol.
After verification of the constructs by sequencing, midipreps of the
destination vectors were created and DNA concentrations were determined.
Table 3: DNA quantification of pcDNA-DEST 53 with 100 and 75 CAA repeats from midipreps.
The A260/A280 ratios are calculated to estimate DNA purity. Nucleic acids only absorb UV light. The UV light absorbance allows Biologists to estimate the concentration and purity of DNA.At 260 nm, DNA has the maximum absorbance. An A260/280 ratio of 1.8 determines pure DNA.
The concentrations of both constructs were too low and the absorbance ratios of these constructs were below 1.8 which indicates protein contamination. As the concentrations and yields of plasmid DNA were low, they were measured again using the spectrophotometer.
Table 4: DNA quantification of pcDNA-DEST 53 with 100 and 75 CAA repeats from midipreps.
Table 5: DNA quantification of pcDNA-DEST 53 with 100 and 75 CAA repeats from midipreps.
The concentrations of both constructs did not match up again with Dr Hodges, although the concentrations of both constructs that I measured again were much higher. This again may be due to my incorrect use of the spectrophotometer.
Sequencing of the two midipreps of both of the constructs in pcDNA-DEST 53 exactly matched to the sequencing of the 2 corresponding minipreps of both of the constructs in pcDNA-DEST 53.Both of these constructs were in frame with respect to pcDNA-DEST 53.One construct contained 100 CAA repeats whilst the other construct consisted of 75 CAA repeats. The constructs pcDNA-DEST 53 with 100 and 75 CAA repeats, Q62N/pcDNA-DEST 53 and plasmid midiprep Gus control in pcDNA-DEST 53 were used in the transfection experiment.
4.2 Detection of the fusion protein
There were a higher proportion of PC12 cells in C1, C3 and C4 wells on the day after transfection in comparison to the flasks to the PC12 cells that were present in A1 and A2 wells.B1-B4 had considerable amounts of PC12 cells. These are detailed in table 6 below. PC12 cells do not stick to collagen coated coverslips very well, so a high proportion of PC12 cells were lost when the media was removed during the method for fixing cells for GFP-fusion protein localisation. Few cells with nuclei which were located easily on the slide had a weak GFP fluorescence by using a Hoechst stain.
The PC12 cells that were in the C1 well were in clumps and these clumps showed a faint green fluorescent light. The PC12 cells that were transfected with DNA fragments with 100 and 75 CAA repeats were round, flattened or polygonal in shape.DNA fragments with 100 and 75 CAA repeats were found to be in the nucleus. Overall PC12 cells transfected with the Gus control had a faint GFP fluorescence and PC12 cells transfected with pcDNA-DEST 53 containing 100 and 75 CAA repeats and Q62N/pcDNA-DEST 53 showed a clear perinuclear GFP fluorescence. The Q62N/pcDNA-DEST 53 construct was made by a previous student and this construct consisted of 62 glutamine repeats.Transfection efficiency was very low and there was evidence of a faint GFP fluorescence. So optimization is needed to verify these preliminary results.
Table 6: The number of cells in each of the wells and the cells that have stained nuclei green.
The most number of cells that have stained the nuclei green were found in high proportion in C1-C4 cells as high amounts of lipofectamine were used and this was in the 1:5 ratio. This could possibly be because high amounts of lipofectamine can cause plasmid DNA fragments to enter into the cell and surround the nucleus.A1-A4 wells showed the same amount of cells that had nuclei stained as B1-B4 wells even though the lipofectamine ratios were 1:0.5 for A1-A4 wells and 1:5 for B1-B4 wells. I found out that by treating cells with trypsin optimised my plating homogeneity and I found it was easy to pipette equal amounts of cells in all 12 wells using a volume of 800 µl.
5 Discussion
Overall minipreps and midipreps resulted in good quality sequences which made me determine precisely the repeat length and confirmation that the Q100 and Q75 in pcDNA-DEST 53,Q62N/pcDNA-DEST53 and gus in pcDNA-DEST 53 was in frame with respect to the insert and tag. The outcome of the results were reasonable but it was really difficult to see any difference in the GFP fluorescence staining between the control vector which is the gus construct in pcDNA-DEST 53 and the three constructs containing varying polyglutamine fragments. In B4, C1, C3 and C4 slides, it was difficult to count the PC12 cells because they were very clumpy and it was difficult to detect the nuclei. In C2 slide, PC12 cells were wide apart and most of the PC12 cells were located at the ends of the coverslips.In B1 and B2 slides, staining was very faint and there were a few proportion of cells that had stained green nuclei. In A1 and A2 slides, the PC12 cells were less clumpy and there were few of them. In A3 and A4 slides, few PC12 cells were located in the middle of the coverslip, the PC12 cells were less clumpy and most of PC12 cells were located mostly at the ends of the coverslip. However overall, it can be seen that the constructs with 100 and 75 CAA repeats in pcDNA-DEST 53 and Q62N/pcDNA-DEST 53 contained perinuclear aggregates as well as aggregates inside the nucleus because in recent studies it has been shown that N-terminal huntingtin fragments which are produced by proteolytic cleavage of full length huntingtin are capable of entering the nucleus and producing aggregates (Hackam et al, 1998). This was also the case for majority of cells with 150Q repeats transfected into PC12 cells (Li et al, 2000).This clearly shows that expanded polyglutamine causes huntingtin to accumulate in the nucleus. In a previous study,huntingtin exon 1 proteins with a polyglutamine repeat in the range of 51 to 83 glutamines transfected into human 293 Tet-off cells produce aggresome like perinuclear inclusions(Waelter et al,2001).These structures consisted of aggregated,ubiquitinated Huntington exon 1 protein with a distinctive fibrillar morphology. It was also found out that Gus in pcDNA-DEST 53 either had no GFP signal and some cells had a faint diffuse fluorescence throughout the cytoplasm.
Few cells with the constructs Q100 and Q75 in pcDNA-DEST 53 and Q62N/pcDNA-DEST 53 had GFP staining. This may be due to incorrectly following the transfection procedure. The transfection efficiency was probably 50% as the cells were only 60-65% confluent on the day that I used these cells for transfection.The PC12 cells were found to have the highest transfection efficiency when the cells are 90-95% confluent. From previous studies PC12 cells that express a huntingtin construct were found to have aggregates in the cytoplasm. This is shown for the cells that contain the gus construct which demonstrated faint diffuse fluorescence. The gus construct was made because when it is transfected into PC12 cells it will lead to no perinuclear aggregation as opposed to PC12 cells transfected with pcDNA-DEST53 containing Q75 and Q100 repeats.
Methodological considerations
The concentration and yields determined from minipreps and midipreps led to incorrect readings because of my inaccuracy in following the procedures correctly. The QIAGEN QIAprep miniprep kits are extremely reliable with reproducible yields and purity. This means the low concentrations determined were because of the inaccurate use of the spectrophotometer. The QIAprep spin miniprep kit from QIAGEN is quick and does not require the use of resins, slurries or phenol extractions. A vital step in the miniprep procedure is to centrifuge for the maximum time for 60 seconds and by doing this it produces efficient results. This was not done when I did the centrifugation step.
To purify DNA quickly and obtain more reproducible results, a GenElute plasmid miniprep kit from Sigma-Aldrich can be used because it is easy to use and this kit can be used to obtain fast and reliable results.
Also by using the Sigma-Aldrich’s GenElute plasmid miniprep kit, the purification of DNA is rapid, it’s cheap, easy, and reproducible and produces high DNA yield by up to 25 µg of high quality plasmid DNA.The low DNA yields could also be due to using the spectrophotometer incorrectly to measure DNA concentrations. Here are some possible explanations:
- Air bubbles in the cuvettes could lead to inaccurate DNA concentrations.
- There could be particulates in the DNA sample picked up from benches which will scatter light when transferring to cuvettes and cause significantly high absorbance readings than the normal reading.
- Incomplete mixing of the sterile milliQ water and the plasmid DNA can lead to improper results.
- The cuvettes may be dirty on the inside because I washed these cuvettes with only sterile milliQ water and I think that these cuvettes should be washed thoroughly with clean high quality solvents to eliminate any particulates.
- There may be residual water in the cuvette before adding the DNA sample. This will dilute the sample which will result in a low reading.
The PC12 cell line is difficult to transfect mainly because they are small, contain reduced amounts of cytoplasm and have a prolonged doubling time (Spratt et al, 1998).So a different cell line could have been used such as human 293 Tet-off cells,SK-N-SH human neuroblastoma etc.
The experiment was not a fair test because the number of cells that were put into each well were 60-70% on the day of transfection and should be 90-95% confluent to increase the efficiency of transfection. So to improve the experiment, I would use a Neubauer improved haemocytometer to count the PC12 cells. Before the transfection complexes were added, the PC12 cells were 60 to 70 % confluent. This was particularly observed for the A1 and A2 wells. If the cell density is too low, this can cause a poor uptake of the transfection complexes which can result in poor expression of the transfected plasmid DNA.Dense cultures which consists of cells that are 80-90 % confluent are more resistant to the toxic effects of the lipid than less dense cultures. The transfection procedure that I used was lipofection.Lipofection is 5 to > 100 fold more effective than the other transfection methods such as calcium phosphate or the DEAE-dextran transfection technique (Felgner et al, 1987).Lipofectamine works by changing the cellular plasma membrane, permitting nucleic acids to cross into the cytoplasm.
As the length of treatment with lipid-DNA complex increases, the transfection efficiency also increases. But the disadvantage that this may pose is that longer incubation times after conducting transfection can cause high levels of toxicity to the PC12 cells. Also in the transfection experiment, medium was not altered after 3-6 hours and was not changed at all. It was only removed while following the procedure for fixing cells for GFP-fusion protein localisation. Changing the medium could improve transfection and hence the expression of the genes of interest. To ensure optimal binding of the negatively charged groups on the surface of PC12 cells to the positive charge on transfection complexes, a suitable positive charge is needed. The degree of binding of the transfection complex to the plasmid DNA can be altered by changing the amounts of lipofectamine or plasmid DNA. Another incorrect procedure that I did was adding antibiotics to the medium during transfection as it can reduce transfection efficiency and result in cell death. I really should have used medium without antibiotics. This could have potentially caused a decrease in the number of PC12 cells that were seen in A1 and A2 wells. In previous studies it has been shown that aggregation of huntingtin relies on protein concentration. This could pose an explanation of why transient transfection of cultured cells resulting in protein expression, can induce huntingtin aggregation even in cells that are dividing. In previous studies during stable transfection, cells which contain huntingtin aggregates may not be able to survive .So for my experiment I used transient transfection of PC12 cells. Furthermore transfection of cells using inducible expression could more accurately regulate the expression of transfected huntingtin and therefore can demonstrate a great relationship between cellular defects and long polyQ repeats. To enhance transfection efficiency, nupherin which is a transfection reagent can be used. Efficient lipofection is reduced by the ability of transfected plasmid DNA to enter the nucleus.Nupherin actively transports plasmid DNA into the nucleus and this enhances the efficiency of transfection.Practical transfection efficiencies can be achieved in dividing cells because the breakdown of the nuclear envelope during mitosis permit sufficient number of plasmids to enter the nucleus.Nupherin contains a cationic peptide fused to a non-classical nuclear localization sequence. Electrostatic interactions between DNA and the peptide are facilitated by the cationic peptide and the nuclear localization sequence uses an endogenous nuclear transport machinery to transport the DNA to the nucleus. Without Nupherin, there is more of a chance that the transfected plasmid DNA will localize in the cytoplasm and will not be expressed resulting in reduced transfection efficiency.
5.1 Validity of results and implications for future research
My results are reasonably valid in the sense that Q100 and Q75 constructs in pcDNA-DEST 53 and Q62N/pcDNA-DEST 53 constructs demonstrate only a few cells with perinuclear aggregates which were a faint fluorescent colour. To further support the studies previously done, an additional experiment should be carried out to determine whether PC12 cells transfected with less than 35 CAA repeats can induce the same effect as seen in humans. I think my results would be further validated by repeatedly carrying out the transfection experiments but because of the time limit, this was not done. But I can safely conclude that long poly CAA repeats contained in D.discoideum induce the same toxic effects as the poly-CAG repeat that cause HD.For future research, a western immunoblot should be carried out to establish the expression of each fusion protein. A western imunoblot will make use of the IC2 antibody that has selective binding to expanded polyglutamine tracts above 38Q and a GFP antibody. This will establish whether the fusion protein is soluble or insoluble.Kinases such as cdk5 phosphorylate htt and protects htt from cleavage by caspases.It would be interesting to experiment this fact as cleavage of mutant htt by caspase generates polyQ htt fragments which aggregate more efficiently. Studies have implicated that a neuropathological model of Huntington’s disease such as the transgenic mouse for exon1 of the HD gene consists of a nuclear membrane that demonstrates an enhanced number of indentations and an increase in density of nuclear pores(Petersen et al,1998).In my study I could further investigate whether this occurs in my experiment.
5.2 Conclusion
Studies in this cell model show that polyglutamine expansion with CAA repeat constructs causes uniform cellular aggregates in the nucleus of PC12 cells. In my results the Q100, Q75 and Q62N constructs reflect this. The results from transfection show that polyglutamine containing proteins were possible to be expressed in PC12 cells.D.discoideum proteins consisting of long polyglutamine proteins chains which are encoded by 100 and 75 CAA repeats in my experiment induce the same aggregation in mammalian cells transfected with mutant htt.The control vector which is gus in pcDNA-DEST 53 contained no perinuclear aggregates.
6 References
(1) Aronin N. Kim M. Laforet G. DiFiglia M. Are there multiple pathways in the pathogenesis of Huntington's disease? Philosophical transactions of the Royal Society B: biological sciences (1999) 354: 995-1003.
(2)Felgner P.L, Gadek T.R, Holm M, Roman R, Chan H.W Wenz M, Northrop J.P Ringold G.M Danielsen M Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proceedings of the National Academy of Sciences of the United States of America: Biochemistry (1987) 84:7413-7417.
(3)Felgner P.L, Gadek T.R, Holm M, Roman R, Chan H.W Wenz M, Northrop J.P Ringold G.M Danielsen M Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proceedings of the National Academy of Sciences of the United States of America: Biochemistry (1987) 84:7413-7417.
(4)Frederick C. Nucifora Jr. Sasaki M. Peters M.F Huang H. Cooper J.K.Yamada M. Takahashi H.Tsuji S.Troncoso J.Dawson V.L Dawson T.M. Ross C.A. Interference by huntingtin and atrophin-1 with CBP-mediated transcription leading to cellular toxicity Science (2001) 291:2423-2428.
(5)Hackam A.S. Singaraja R. Wellington C.L. Metzler M. McCutcheon K. Zhang T. Kalchman M. Hayden M.R. The influence of huntingtin protein size on nuclear localization and cellular toxicity (1998). Journal of Cell Biology. 141:1097-1105.
(6)Klement I.A. Skinner P.J. Kaytor M.D. Yi H. Hersch S.M. Clark H.B. Zoghbi H.Y. Orr H.T. Ataxin-1 nuclear localization and aggregation: Role in polyglutamine- induced disease in SCA1 transgenic mice (1998). Cell. 95:41-53.
(7)Kremer H.P.H. Roos R.A.C. Weight loss in Huntington's disease (1992) .Archives of Neurology. 49:349.
(8)Li S.-H. Lam S Cheng A.L Li X.J. Intranuclear huntingtin increases the expression of caspase-1 and induces apoptosis (2000) Human Molecular Genetics. 9:2859-2867.
(9)Li S.-H Li X.-J. Huntingtin-protein interactions and the pathogenesis of Huntington's disease (2004) Trends in Genetics. 20:146-154.
(10)Michalik A. Van Broeckhoven C. Pathogenesis of polyglutamine disorders: Aggregation revisited(2003) Human Molecular Genetics. 12: R173-R186.
(11)Petersen A. Mani K. Brundin P. Recent advances on the pathogenesis of Huntington's disease(1999). Experimental Neurology. 157:1-18), 1999.
(12) Schilling G Becher M.W Sharp A.H Jinnah H.A. Duan K. Kotzuk J.A., Slunt H.H. Ratovitski T. Cooper J.K. Jenkins N.A. Copeland N.G. Price D.L.Ross C.A. Borchelt D.R. Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin Human Molecular Genetics(1999) 8:397-407.
(13)Sauder F. Finkbeiner S. Devys D. Greenberg M.E. Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell (1998) 95: 55-56.
(14) Spratt.K.K.Transfection of PC12 cells: a model system for primary neuronal cells.Qiagen News (1998).
(15)Taylor J.P. Hardy J. Fischbeck K.H. Toxic proteins in neurodegenerative disease. Science(2002) 296:1991-1995.
(16)Waelter S Boeddrich A. Lurz R. Scherzinger E. Lueder G. Lehrach H. Wanker E.E. Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Molecular Biology of the Cell(2001).12:1393-1407.
(17) Wyttenbach A. Swartz J. Kita H. Thykjaer T. Carmichael J. Bradley J. Brown R. Maxwell M. Schapira A. Orntoft T.F. Kato K. Rubinsztein D.C. Polyglutamine expansions cause decreased CRE-mediated transcription and early gene expression changes prior to cell death in an inducible cell model of Hungtington's disease. Human Molecular Genetics (2001) 10:1829-1845.
(18)Young A.B. Huntingtin in health and disease. Journal of Clinical Investigation(2003). 111:299-302.
7. Acknowledgement
I would like to thank my supervisor Dr Angela Hodges for taking me on this project and having the patience to take the time to show me the different experimental techniques associated with the study. I would also like to thank Obi and Dr Hodges for making the Q62 construct in pcDNA-DEST 53. I would also like to thank Dr Richard Kilick and Dr Mirsada Kausevic for assisting me a great deal when I needed help. In addition I would like to thank other lab staff. I would also like to thank my parents for financially supporting me through this course.
Minipreps for pcDNA-DEST 53 CAA*100
GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGACACCATGGCCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAAGCGGTTCCGGACCGGATCAAACAAGTTTGTACAAAAAAGCAGGCTCTCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAATAGACCCAGCTTTCTTGTACAAAGTGGTGATAATTAATTAAGATAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
CACCATGG-Kozak consensus sequence for mammalian expression
CACAATCTGCCCTTTCGAAA-GFP-For Primer used for sequencing
ATG/TAG –Start and end of sequence that will be translated into a protein.
TAATACGACTCACTATAGGG-T7 primer used for sequencing.
Pink-Sequence from Dictyostelium and primers (polyglutamine sequence in bold).
Blue-Sequence inherited from Pentr/sd/d/topo.
Green-GFP tag
Minipreps for pcDNA-DEST 53 CAA * 75
GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGACACCATGGCCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAAGCGGTTCCGGACCGGATCAAACAAGTTTGTACAAAAAAGCAGGCTCTCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAATAGACCCAGCTTTCTTGTACAAAGTGGTGATAATTAATTAAGATAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
CACCATGG-Kozak consensus sequence for mammalian expression.
CACAATCTGCCCTTTCGAAA-GFP-For Primer used for sequencing
ATG/TAG –Start and end of sequence that will be translated into a protein.
TAATACGACTCACTATAGGG-T7 primer used for sequencing.
Pink-Sequence from Dictyostelium and primers (polyglutamine sequence in bold).
Blue-Sequence inherited from Pentr/sd/d/topo.
Green-GFP tag
Midipreps for pcDNA –DEST 53 CAA * 100
GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGACACCATGGCCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAAGCGGTTCCGGACCGGATCAAACAAGTTTGTACAAAAAAGCAGGCTCTCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAATAGACCCAGCTTTCTTGTACAAAGTGGTGATAATTAATTAAGATAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
CACCATGG-Kozak consensus sequence for mammalian expression
CACAATCTGCCCTTTCGAAA-GFP-For Primer used for sequencing
ATG/TAG –Start and end of sequence that will be translated into a protein.
TAATACGACTCACTATAGGG-T7 primer used for sequencing.
Pink-Sequence from Dictyostelium and primers (polyglutamine sequence in bold).
Blue-Sequence inherited from Pentr/sd/d/topo.
Green-GFP tag
Midipreps for pcDNA –DEST 53 CAA * 75
GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGACACCATGGCCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAAGCGGTTCCGGACCGGATCAAACAAGTTTGTACAAAAAAGCAGGCTCTCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAATAGACCCAGCTTTCTTGTACAAAGTGGTGATAATTAATTAAGATAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
CACCATGG-Kozak consensus sequence for mammalian expression
CACAATCTGCCCTTTCGAAA-GFP-For Primer used for sequencing
ATG/TAG –Start and end of sequence that will be translated into a protein.
TAATACGACTCACTATAGGG-T7 primer used for sequencing.
Pink-Sequence from Dictyostelium and primers (polyglutamine sequence in bold).
Blue-Sequence inherited from Pentr/sd/d/topo.
Green-GFP tag
Gus in pcDNA-DEST53 GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGACACCATGGCCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAAGCGGTTCCGGACCGGATCAAACAAGTTTGTACAAAAAAGCAGGCTCATTTAACTTTAAGAAGGAGATATATACCATGGTCCGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTGGATCGCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGGCTTGCCAGGCAGTTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAAGTCTTTATACCGAAAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAAAGTGTGGGTCAATAATCAGGAAGTGATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTATCACCGTTTGTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGAAAACGGCAAGAAAAAGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGCCGAACACCTGGGTGGACGATATCACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCGTCTGTTGACTGGCAGGTGGTGGCCAATGGTGATGTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGACTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGTGCGTCACAGCCAAAAGCCAGACAGAGTGTGATGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGGCGGCCGCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGATTTTGAGTTAGGATCCGTCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCCGGCTTACTAAAAGCCAGATAACAGTATGCGTATTTGCGCGCTCGCGAACCGGTGTATACCCGAAGTATGTCAAAAAGAGGTATGCTATGAAGCAGCGTATTACAGTGACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCATATATGATGTCAATATCTCCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTCGTCTGCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCGCCCGGTTTATTGAAATGAACGGCTCTTTTGCTGACGAGAACAGGGGCTGGTGAAATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCTCCCTTATACACAGCCAGTCTGCAGGTCGACCATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTCTTGTACAAAGTGGTGATAATTAATTAAGATAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
CACCATG-Kozak consensus sequence for mammalian expression.
CACAATCTGCCCTTTCGAAA-GFP-For Primer used for sequencing.
ATG/TAG –Start and end of sequence that will be translated into a protein.
TAATACGACTCACTATAGGG-T7 primer used for sequencing.
Pink- cDNA Sequence from the gene Gus.
Blue-Sequence inherited from Pentr/sd/d/topo.
Green –GFP tag
Figure 1a: Cluster of PC12 cells transfected with Q100 repeats
Figure 2b: The same cluster of PC12 cells transfected with Q100 repeats showing staining of nuclei and perinuclear aggregates.
Figure 3a: Another cluster of PC12 cells that have been transfected with Q100 repeats
Figure 3b: The same cluster of PC12 cells transfected with Q100 repeats showing staining of nuclei and perinuclear aggregates.
Figure 4a: A cluster of PC12 cells that have been transfected with Q75 repeats
Figure 4b: The same cluster of cells that have been transfected with Q75 repeats showing faint staining of the nuclei.
Figure 5a: A cluster of PC12 cells that are transfected with the gus control.
Figure 5b: The same cluster of PC12 cells that are transfected with the gus control showing no GFP signal.
Figure 6a: A cluster of PC12 cells transfected with Q62N construct.
Figure 6b: The same cluster of PC12 cells transfected with the Q62N construct showing a perinuclear aggregate and staining