• Join over 1.2 million students every month
  • Accelerate your learning by 29%
  • Unlimited access from just £6.99 per month

Polymerase Chain Reaction, or PCR Applications.

Extracts from this document...


PCR Applications Polymerase Chain Reaction, or PCR, is a procedure that was invented in the late 1980's and is widely used in the selective amplification of a chosen region of a DNA molecule. This chosen region can be from any part of the DNA molecule, however PCR will only work if the base sequences of the 3' and 5' ends are known. This is to ensure that two short oligonucleotides, acting as primers, can anneal onto the DNA strands and initiate DNA synthesis reactions. The process of PCR is dependant on the thermostable DNA pol I enzyme from the bacterium Thermus aquaticus The basic procedure of PCR is several cycles of denaturation, hybridisation and synthesis resulting in the eventual synthesis of several hundred million copies of the amplified DNA fragment (see Fig.1 for the overall stages of PCR). Following its completion, a sample of the mixture is analysed by agarose gel electrophoresis, where it is visible as a discrete band by staining with Ethidium Bromide. ...read more.


Genetic profiling is used to identify differences in the human genome in different people. An example is identifying kinship, where each individual carry different versions of short tandem repeats known as microsatellites. They can be passed onto offspring, hence allowing scientists to solve problems where there are paternal uncertainties. PCR can be used when carrying out prenatal screening of fetus to determine if it is carrying any genetic diseases. One example is to identify whether the fetus is carrying the cystic fibrosis gene. Cystic fibrosis is caused by a 3bp deletion that leads to a protein, which lacks a critical phenylalanine amino acid. PCR primers have been developed that can distinguish normal gene from mutant gene. With these primers, a 154bp product is produced from a normal individual and a 151bp product is amplified from DNA of an individual with the disease. ...read more.


This PCR can be used to check if the Mst I restriction site is present; this is simply done by adding the Mst I restriction enzyme prior to PCR. If two bands appear it indicates that the restriction site is present and if one band appears then the restriction site is not present. PCR can surprisingly be applied to RNA, its specific name being reverse transcriptase-PCR (PCR on RNA via cDNA). This measures the amounts of an mRNA in different tissues or in the same tissue at different times. Its amounts in the cell reflect the activity of the parent gene; therefore quantification of mRNA enables changes in gene expression to be monitored. The above examples are only a few of the diverse applications of PCR and it is hard to exaggerate the impact of the polymerase chain reaction. Generally PCR is a quick and easy method for generating unlimited scientific development. Basically PCR is without doubt the major scientific development of the last quarter century. ...read more.

The above preview is unformatted text

This student written piece of work is one of many that can be found in our University Degree Genetics section.

Found what you're looking for?

  • Start learning 29% faster today
  • 150,000+ documents available
  • Just £6.99 a month

Not the one? Search for your essay title...
  • Join over 1.2 million students every month
  • Accelerate your learning by 29%
  • Unlimited access from just £6.99 per month

See related essaysSee related essays

Related University Degree Genetics essays

  1. Using DNA to Solve Crimes.

    Then, in February 2001, the DNA sample was matched to an individual who was already serving a five-year sentence for an unrelated 1997 sexual assault of a child. The man has since been convicted of capital murder and aggravated sexual assault.

  2. The Principles and Methodology of 2D Electrophoresis and its Application in Proteomics and Disease ...

    for separation and characterisation of complex protein mixtures. Among the difficulties associated with this approach is the solubilisation of protein mixtures for isoelectric focusing (IEF)"8. A new approach to the method of solubilisation has been developed by using the Taguchi approach, "Taguchi methods are statistical methods developed by Genichi Taguchi to improve the quality of manufactured goods"9.

  1. The Integration of DNA Applications in Forensic Science

    Another method of DNA typing is Short Tandem Repeat (STR), which uses shorter repeat units of DNA nucleotide sequences of 2 to 5 base pair units in length. They are found throughout the chromosomes in vast quantities, increasing the availability for loci to be exposed and verified (NRC, 1996).

  2. DNA Fingerprinting: A review of the criticisms of DNA evidence. Is it really the ...

    the result of stringency24, he could not however, explain the discrepancy of the other band and therefore claimed that the two DNA profiles produced a mis-match. The Court of Appeal in its judgement did not doubt that this appeal would be allowed.

  1. Objectives:To amplify a 500bp fragment of lambda DNA. To understand the principles and the ...

    The upshot is that bases complementary to the template are coupled to the primer. Materials and Methods: * DNA sample(? DNA - 0.1?g/ml) * Primer 1:5' GATGAGTTCGTGTCCGTACAACTGG 3' * Primer 2:5' GGTTATCGAAATCAGCCACAGCGCC 3' * Nucleotide mix (dATP, dCTP, and dTTP - 1.25 mM each)

  2. DNA amplification by Polymerase chain reaction (PCR).

    The primers should have a melting temperature (Tm) that allows annealing at temperatures of 55°-65°C and are designed to provide starting point for the synthesis of new DNA strands, complementary to the target DNA. If the primer is shorter than 25 nucleotides, Tm is calculated using the following formula; Tm = 4(G+C)

  1. Explain How The Development of Electrophoretic Techniques has played a key role in (a) ...

    With the introduction of capillary electrophoresis it has made it possible to separate much smaller proteins and has advanced our knowledge in the structure and sequence of our DNA and has also been a successful tool in the field of gene technology by giving us the understanding of how the genes work and can be manipulated.

  2. Biology - PCR Lab

    Cheek cells were the source of the template DNA that was isolated. Thousands of cells were collected by using a saline mouthwash and placed in a centrifuge to separate them from other unwanted debris. The cells were then resuspended in a solution containing Chelex beads, which were negatively charged.

  • Over 160,000 pieces
    of student written work
  • Annotated by
    experienced teachers
  • Ideas and feedback to
    improve your own work